Both T24 and MCF-7 cells were found to express HIF1α after hypoxic induction (Ref. Finally, efficient and selective prodrug-mediated toxicity was observed when the Epo/E9 promoter controlled the expression of HRP after combined hypoxia and radiation treatment Figure 5. The present work has also highlighted some important considerations concerning the choice of promoter framework and marker gene. 3).      For each data point, at least three independent experiments (triplicate samples) were performed. The cells were subsequently re-seeded at low density and incubated in air for 24 h with the prodrug IAA. Author contributions: J.C.-G. and J.L.-B. Gene Ther 9, 1403–1411 (2002). The fold-induction was defined as the ratio of EGFP expression after radiation compared with sham-treatment. Further improvements to the combinational promoter system may be achieved by optimizing the spacing between the elements, as well as their number and orientation and distance from the transcription start site.      Microorganisms and their hosts communicate with each other through an array of signals. Brown JM, Giaccia AJ . Three different HREs were tested, from the human erythropoietin (Epo) gene, the murine phosphoglycerate kinase 1 (PGK1) gene, and a novel sequence based on the human vascular endothelial growth factor HRE (nVEGF). This observation is consistent with the bystander effect demonstrated previously with the HRP/IAA system.1112 Although IAA incubation was performed in normoxia, the HRP/IAA system can induce cell death and bystander killing in hypoxia (0.1% O2) and in the extreme tumor conditions of anoxia.1112 Moreover, HRP/IAA could significantly enhance the cytotoxic effects of IR, when X-irradiation took place immediately before or after prodrug incubation.10 This system is therefore a promising candidate for use in a combined radiotherapy and gene therapy approach. We thank Drs. Other chimeric promoters based on the CMV basal gene promoter have shown robust hypoxic35 and radiation1516 inducibility.                         PubMed Google Scholar. These updated consensus guidelines were written under the auspices of the WSES by the acute appendicitis working group. Inflammatory diseases, https://doi.org/10.1016/j.carpath.2015.05.001. To our knowledge, these studies represent the first reports showing IR-inducibility of HREs. All HREs were significantly induced by hypoxia Figure 2. 46 and C Coralli, personal communication). Gene therapy approaches based on the selective expression of therapeutic genes present a number of distinctive advantages.1718 Artificial hybrid promoters can offer specificity, as well as applicability in a wide range of cancer types, complementing and enhancing the properties of the different components.19 They are also characterized by flexibility, because several elements of different origin can be arranged in various orders, numbers and relative orientations, in order to optimize gene regulation. The pCD4 plasmid encoding the marker CD4 was used as a negative control. Hypoxia-inducible factor 1 is a basic helix-loop-helix-PAS heterodimer regulated by cellular O2 tension Proc Natl Acad Sci USA 1995 92: 5510–5514, O'Rourke JF et al. ↵*This Direct Submission article had a prearranged editor. The results presented here demonstrate, for the first time, robust and tight regulation of gene expression via HRE/CArG chimeric promoters. Coralli C et al. Interestingly, IR-induced VEGF production has been noted in tumor cells in vitro and in vivo, with a ~two-fold increase in VEGF levels 24 h after 5 Gy.37 ROS have been shown to play a role in the expression of Epo, PGK1 and VEGF in response to hypoxia,32 by stabilizing HIF1α.33 Differentiated C2C12 myoblasts and endothelial cells exposed to ROS-producing agents exhibited a concentration-dependent increase in VEGF production in vitro and in vivo.383940 Moreover, the flavoprotein diphenylene iodonium, which blocks ROS generation by NAD(P) oxidase, abolishes the hypoxic induction of HIF1-regulated genes.41 In contrast, H2O2 inhibited HIF1 binding and Epo induction under hypoxia.42 This could reflect cellular damage by an overwhelming antioxidant response, since low H2O2 levels did allow activity of the Epo and Glut1 HREs.3343 Further studies are required to elucidate the mechanisms involved in IR-mediated HRE activation. After 24 h 0.1% O2 treatment Figure 2, PGK1/E9, Epo/E9 and nVEGF/E9 enhancers were characterized by induction levels of 1.4 (±0.2), 3.0 (±0.6) and 2.0 (±0.4) in T24 cells, and of 1.9 (±0.4), 3.4 (±0.2) and 1.3 (±0.2) in the MCF-7 cell line. Despite being an independent prognostic marker of poor treatment outcome, hypoxia represents a physiological difference that can be exploited for selective cancer treatment.                     Google Scholar, Ratcliffe PJ, O'Rourke JF, Maxwell PH, Pugh CW .             and JavaScript. For promoter constructs containing CArG elements and either PGK1 or Epo HREs, the latter components were produced in two stages, with the following ODN sequences: for pPGK1/E9: 5’-GATC(TGTCACGTCCTGCACGAC)3-3’ + 5’-GATC(GTCGTGCAGGACGTGACA)3-3’ and 5’-GATC(TGTCACGTCCTGCACGAC)2-3’ + 5’-GATC(GTCGTGCAGGACGTGACA)2-3’, for pEpo/E9: 5’-GATCT(GGCCCTACGTGCTGTCTCACACA)3G-3’ + 5’-GATCC(TGTGTGAGACAGCACGTAGGGCC)3A-3’ and 5’-GATCT(GGCCCTACGTGCTGTCTCACACA)2G-3’ + 5’-GATCC(TGTGTGAGACAGCACGTAGGGCC)2A-3’. Construction details are given in Materials and methods. Such an approach would be applicable to all tumor types treated by conventional radiotherapy and could be readily combined with standard-dose regimes. Transport into and out of the Golgi complex studied by transfecting cells with cDNAs encoding horseradish peroxidase J Cell Biol 1994 127: 641–652, Hart SL et al. As predicted, IAA killed only cells transfected with pCMV-HRP under normoxic conditions Figure 5. Also, adding five extra HREs, in the PGK110/E9 promoter, did not lead to a corresponding increase in response, when compared with PGK1/E9 Figures 2Figures 3Figures 4. **, Significantly different from the corresponding HRE (P < 0.05). The sequence integrity of all plasmids was confirmed using a Thermo Sequenase Cycle Sequencing Kit (Amersham Pharmacia Biotech, Amersham, UK) and a Gene Readir DNA Analyzer (LI-COR, Lincoln, USA).